Descripción
Registros
Los datos en este recurso de registros biológicos han sido publicados como Archivo Darwin Core(DwC-A), el cual es un formato estándar para compartir datos de biodiversidad como un conjunto de una o más tablas de datos. La tabla de datos del core contiene 200 registros.
también existen 1 tablas de datos de extensiones. Un registro en una extensión provee información adicional sobre un registro en el core. El número de registros en cada tabla de datos de la extensión se ilustra a continuación.
Este IPT archiva los datos y, por lo tanto, sirve como repositorio de datos. Los datos y los metadatos del recurso están disponibles para su descarga en la sección descargas. La tabla versiones enumera otras versiones del recurso que se han puesto a disposición del público y permite seguir los cambios realizados en el recurso a lo largo del tiempo.
Versiones
La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.
¿Cómo referenciar?
Los usuarios deben citar este trabajo de la siguiente manera:
Haderlé R, Ung V, Jung J (2024). eDNA-based survey of the marine vertebrate biodiversity off the west coast of Guadeloupe (French West Indies). Version 1.7. MNHN - Museum national d'Histoire naturelle. Occurrence dataset. https://ipt.gbif.fr/resource?r=edna_marine_vertebrates_guadeloupe&v=1.7
Derechos
Los usuarios deben respetar los siguientes derechos de uso:
El publicador y propietario de los derechos de este trabajo es MNHN - Museum national d'Histoire naturelle. Esta obra está bajo una licencia Creative Commons de Atribución/Reconocimiento (CC-BY 4.0).
Registro GBIF
Este recurso no ha sido registrado en GBIF
Palabras clave
Occurrence; Environmental DNA; Vertebrates; West Indies; 12S Mitochondrial Ribosomal RNA; Metabarcoding
Contactos
- Proveedor De Los Metadatos ●
- Originador ●
- Punto De Contacto
- PhD student
- Originador
- Research engineer
- Originador
- Research Director
- Usuario
Cobertura geográfica
The Guadeloupe islands are located in the Caribbean Sea, at the heart of the Agoa sanctuary, a large marine protected area (over 143,000 km²) corresponding to the entire French Exclusive Economic Zone of the French West Indies and dedicated to the protection and conservation of marine mammals. The sampling area is located on the west coast of Guadeloupe island on the Caribbean Seaside, the leeward coast, off the commune of Bouillante in Basse Terre. The sampling transect was approximately 5 km long. This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). This specific zone was selected because of the drop-off and numerous sightings of cetaceans, with a particular emphasis on Physeter macrocephalus, as regularly reported by whale watchers in this area (Coché et al. 2021).
| Coordenadas límite | Latitud Mínima Longitud Mínima [16,103, -61,841], Latitud Máxima Longitud Máxima [16,103, -61,841] |
|---|
Cobertura taxonómica
N/A
| Reino | Animalia |
|---|---|
| Filo | Chordata |
| Class | Mammalia, Actinopterygii |
| Orden | Stomiiformes, Beloniformes, Cetacea, Perciformes, Acanthuriformes, Scombriformes, Carangiformes, Aulopiformes, Acropomatiformes, Myctophiformes, Trachiniformes |
| Familia | Chiasmodontidae, Bramidae, Pomacanthidae, Stomiidae, Scombridae, Coryphaenidae, Exocoetidae, Carangidae, Myctophidae, Istiophoridae, Labridae, Chaetodontidae, Bathyclupeidae, Nomeidae, Scopelarchidae, Delphinidae, Lutjanidae, Belonidae, Hemiramphidae, Neoscopelidae, Pomacentridae, Evermannellidae, Gempylidae |
Cobertura temporal
| Fecha Inicial / Fecha Final | 2021-06-06 / 2022-02-11 |
|---|
Datos del proyecto
The project consisted in taking and analysing eDNA samples using, on consecutive days, a same protocol on a same transect along the west coast of Guadeloupe. Twelve samples were taken. Two sampling phases were carried out: one in 2021 over four consecutive days, the other in 2022 over two consecutive days. eDNAs contained in the samples were analysed by metabarcoding using vertebrate–specific primers (Taberlet et al. 2018).
| Título | eDNA-based survey of the marine vertebrate biodiversity off the west coast of Guadeloupe (French West Indies) |
|---|---|
| Fuentes de Financiación | Data were collected during a dedicated campaign to study eDNA in the French Caribbean archipelago of Guadeloupe, organized and financed by the UMR ISYEB and the Labex DRIIHM, and beneficiating of a collaboration with the NGO OMMAG (Observatoire des Mammifères Marins de l’Archipel Guadeloupéen - Guadeloupe Archipelago Marine Mammal Observatory) for at sea campaigns. |
| Descripción del área de estudio | The Guadeloupe islands are located in the Caribbean Sea, at the heart of the Agoa sanctuary, a large marine protected area (over 143,000 km²) corresponding to the entire French Exclusive Economic Zone of the French West Indies and dedicated to the protection and conservation of marine mammals. The sampling area is located on the west coast of Guadeloupe island on the Caribbean Seaside, the leeward coast, off the commune of Bouillante in Basse Terre. The sampling transect was approximately 5 km long. This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). This specific zone was selected because of the drop-off and numerous sightings of cetaceans, with a particular emphasis on Physeter macrocephalus, as regularly reported by whale watchers in this area (Coché et al. 2021). |
Métodos de muestreo
All samples were collected from a motorised rigid inflatable boat during 30 minutes at a 5-knot speed. For all samples, the boat followed a same transect defined on top of a marked bathymetric drop-off parallel to the coast. During each transect, two samples of seawater were collected in front of the boat, one from each side of the boat, just below the sea surface. For each sample, 30L of sea water were continuously filtered through a VigiDNA 0.2 μM filtration capsule (SPYGEN, France) using an Athena peristaltic pump (Proactive, Hamilton, NJ, USA), as described in Dalongeville et al. (2022). Right after the completion of the procedure, each capsule was filled with 80 mL of CL1 DNA preservation buffer (SPYGEN) and stored at room temperature until DNA extraction.
| Área de Estudio | This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). Two sampling phases were carried out: one in 2021 on four consecutive days (from 06/06/2021 to 06/09/2021), the other in 2022 on two consecutive days (02/10/2022 and 02/11/2022). |
|---|---|
| Control de Calidad | Data were checked for errors: 10% of MOTUs were randomly selected and checked by two people: taxonomic assignment was repeated and the number of reads per sample was confirmed. No errors were detected. |
Descripción de la metodología paso a paso:
- DNA extraction and amplification were performed by a dedicated DNA laboratory (SPYGEN, www.spygen.com). PCR amplification was performed using a universal vertebrate 12S mitochondrial rDNA primer pair Vert01 (TAGAACAGGCTCCTCTAG and TTAGATACCCCACTATGC, Taberlet et al. 2018). The amplicons were then sequenced using an Illumina MiSeq sequencer (Illumina, San Diego, CA, USA). The resulting sequence datasets (read sets) were analysed using the OBITools package (Boyer et al. 2015) for taxonomic assignment. Each MOTU, representing a grouping of sequences based on their molecular similarity, was associated with a number of reads per sample. MOTUs were named using the following nomenclature: Gua_Boui_V_Year_n°MOTU; with Gua for Guadeloupe, Boui, a 4-letter code for "Bouillante" (commune located on the shore the closest to the transect), V for the primer used, in this case specific to vertebrates, the sampling year (2021 or 2022), and a number corresponding to the order of appearance of the MOTU in the overall list. The taxonomic assignment of each MOTU was meticulously checked by hand. To compare the taxonomic resolution and the detection powers of different primers, two samples SPY210556 and SPY204197, respectively taken the 06/06/2021 and the 06/09/2021, were also analysed with a pair of primers specific to teleosts, Tele01 (ACACCGCCCGTCACTCT, CTTCCGGTACTACCATG, Valentini et al. 2016). Similarly, the 2021 samples (SPY204198, SPY204172, SPY210555 and SPY204197) were also analysed with a pair of Mamm01 mammal-specific primers (CCGCCCGTCACYCTCCT, GTAYRCTTACCWTGTTACGAC, Taberlet et al. 2018) and with a pair of cetacean-specific primers 175f-407r (CATACGATAAGTTAAAGCTCG, GATCATTACTAGCTACCCCC, Girardet & Jung. unpublished).
Referencias bibliográficas
- Boyer, F., Mercier, C., Bonin, A., Le Bras, Y., Taberlet, P. and Coissac, E. (2016). obitools: a unix-inspired software package for DNA metabarcoding. Mol Ecol Resour 16, 176–182.
- Coché, L., Arnaud, E., Bouveret, L., David, R., Foulquier, E., Gandilhon, N., Jeannesson, E., Le Bras, Y., Lerigoleur, E., Lopez, P. J., et al. (2021). Kakila database: Towards a FAIR community approved database of cetacean presence in the waters of the Guadeloupe Archipelago, based on citizen science. Biodivers Data J 9, e69022.
- Dalongeville, A., Boulanger, E., Marques, V., Charbonnel, E., Hartmann, V., Santoni, M. C., Deter, J., Valentini, A., Lenfant, P., Boissery, P., et al. (2022). Benchmarking eleven biodiversity indicators based on environmental DNA surveys: More diverse functional traits and evolutionary lineages inside marine reserves. Journal of Applied Ecology59, 2803–2813.
- Taberlet, P., Bonin, A., Zinger, L. and Coissac, E. (2018). Environmental DNA: For Biodiversity Research and Monitoring. Oxford University Press.
- Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P. F., Bellemain, E., Besnard, A., Coissac, E., Boyer, F., et al. (2016). Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology 25, 929–942.
Metadatos adicionales
| Identificadores alternativos | https://doi.org/10.48579/PRO/EHR5AC |
|---|---|
| https://ipt.gbif.fr/resource?r=edna_marine_vertebrates_guadeloupe |