Описание
Data were collected during a dedicated campaign to study eDNA in the French Caribbean archipelago of Guadeloupe, organized and financed by the UMR ISYEB and the Labex DRIIHM, and beneficiating of a collaboration with the NGO OMMAG (Observatoire des Mammifères Marins de l’Archipel Guadeloupéen - Guadeloupe Archipelago Marine Mammal Observatory) for at sea campaigns.
The project consisted in taking and analysing eDNA samples using, on consecutive days, a same protocol on a same transect along the west coast of Guadeloupe. Twelve samples were taken. Two sampling phases were carried out: one in 2021 over four consecutive days, the other in 2022 over two consecutive days. eDNAs contained in the samples were analysed by metabarcoding using vertebrate–specific primers (Taberlet et al. 2018). The resulting dataset consisted in lists of vertebrate taxa identified from analysed MOTU (Molecular Taxonomic Unit - a grouping of sequences based on their molecular similarity) in the different samples. The taxonomic assignments were made at the most precise taxonomic rank possible.
The project resulted in a local taxonomic inventory of marine vertebrates based on eDNA. Comparison between samples provided an overview of the short and middle terms temporal variations in taxonomic composition at a single sampling point, as captured by our eDNA sampling and analysis protocols.
Записи данных
Данные этого occurrence ресурса были опубликованы в виде Darwin Core Archive (DwC-A), который является стандартным форматом для обмена данными о биоразнообразии в виде набора из одной или нескольких таблиц. Основная таблица данных содержит 200 записей.
Также в наличии 1 таблиц с данными расширений. Записи расширений содержат дополнительную информацию об основной записи. Число записей в каждой таблице данных расширения показано ниже.
Данный экземпляр IPT архивирует данные и таким образом служит хранилищем данных. Данные и метаданные ресурсов доступны для скачивания в разделе Загрузки. В таблице версий перечислены другие версии ресурса, которые были доступны публично, что позволяет отслеживать изменения, внесенные в ресурс с течением времени.
Версии
В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.
Как оформить ссылку
Исследователи должны дать ссылку на эту работу следующим образом:
Haderlé R, Ung V, Jung J (2024). eDNA-based survey of the marine vertebrate biodiversity off the west coast of Guadeloupe (French West Indies). Version 1.7. MNHN - Museum national d'Histoire naturelle. Occurrence dataset. https://ipt.gbif.fr/resource?r=edna_marine_vertebrates_guadeloupe&v=1.7
Права
Исследователи должны соблюдать следующие права:
Публикующей организацией и владельцем прав на данную работу является MNHN - Museum national d'Histoire naturelle. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).
Регистрация в GBIF
Этот ресурс не был зарегистрирован в GBIF
Ключевые слова
Occurrence; Environmental DNA; Vertebrates; West Indies; 12S Mitochondrial Ribosomal RNA; Metabarcoding
Контакты
- Originator
- Research engineer
- Originator
- Research Director
Географический охват
The Guadeloupe islands are located in the Caribbean Sea, at the heart of the Agoa sanctuary, a large marine protected area (over 143,000 km²) corresponding to the entire French Exclusive Economic Zone of the French West Indies and dedicated to the protection and conservation of marine mammals. The sampling area is located on the west coast of Guadeloupe island on the Caribbean Seaside, the leeward coast, off the commune of Bouillante in Basse Terre. The sampling transect was approximately 5 km long. This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). This specific zone was selected because of the drop-off and numerous sightings of cetaceans, with a particular emphasis on Physeter macrocephalus, as regularly reported by whale watchers in this area (Coché et al. 2021).
| Ограничивающие координаты | Юг Запад [16,103, -61,841], Север Восток [16,103, -61,841] |
|---|
Таксономический охват
N/A
| Kingdom | Animalia |
|---|---|
| Phylum | Chordata |
| Class | Mammalia, Actinopterygii |
| Order | Stomiiformes, Beloniformes, Cetacea, Perciformes, Acanthuriformes, Scombriformes, Carangiformes, Aulopiformes, Acropomatiformes, Myctophiformes, Trachiniformes |
| Family | Chiasmodontidae, Bramidae, Pomacanthidae, Stomiidae, Scombridae, Coryphaenidae, Exocoetidae, Carangidae, Myctophidae, Istiophoridae, Labridae, Chaetodontidae, Bathyclupeidae, Nomeidae, Scopelarchidae, Delphinidae, Lutjanidae, Belonidae, Hemiramphidae, Neoscopelidae, Pomacentridae, Evermannellidae, Gempylidae |
Временной охват
| Дата начала / Дата окончания | 2021-06-06 / 2022-02-11 |
|---|
Данные проекта
The project consisted in taking and analysing eDNA samples using, on consecutive days, a same protocol on a same transect along the west coast of Guadeloupe. Twelve samples were taken. Two sampling phases were carried out: one in 2021 over four consecutive days, the other in 2022 over two consecutive days. eDNAs contained in the samples were analysed by metabarcoding using vertebrate–specific primers (Taberlet et al. 2018).
| Название | eDNA-based survey of the marine vertebrate biodiversity off the west coast of Guadeloupe (French West Indies) |
|---|---|
| Финансирование | Data were collected during a dedicated campaign to study eDNA in the French Caribbean archipelago of Guadeloupe, organized and financed by the UMR ISYEB and the Labex DRIIHM, and beneficiating of a collaboration with the NGO OMMAG (Observatoire des Mammifères Marins de l’Archipel Guadeloupéen - Guadeloupe Archipelago Marine Mammal Observatory) for at sea campaigns. |
| Описание района исследования | The Guadeloupe islands are located in the Caribbean Sea, at the heart of the Agoa sanctuary, a large marine protected area (over 143,000 km²) corresponding to the entire French Exclusive Economic Zone of the French West Indies and dedicated to the protection and conservation of marine mammals. The sampling area is located on the west coast of Guadeloupe island on the Caribbean Seaside, the leeward coast, off the commune of Bouillante in Basse Terre. The sampling transect was approximately 5 km long. This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). This specific zone was selected because of the drop-off and numerous sightings of cetaceans, with a particular emphasis on Physeter macrocephalus, as regularly reported by whale watchers in this area (Coché et al. 2021). |
Методы сбора
All samples were collected from a motorised rigid inflatable boat during 30 minutes at a 5-knot speed. For all samples, the boat followed a same transect defined on top of a marked bathymetric drop-off parallel to the coast. During each transect, two samples of seawater were collected in front of the boat, one from each side of the boat, just below the sea surface. For each sample, 30L of sea water were continuously filtered through a VigiDNA 0.2 μM filtration capsule (SPYGEN, France) using an Athena peristaltic pump (Proactive, Hamilton, NJ, USA), as described in Dalongeville et al. (2022). Right after the completion of the procedure, each capsule was filled with 80 mL of CL1 DNA preservation buffer (SPYGEN) and stored at room temperature until DNA extraction.
| Охват исследования | This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). Two sampling phases were carried out: one in 2021 on four consecutive days (from 06/06/2021 to 06/09/2021), the other in 2022 on two consecutive days (02/10/2022 and 02/11/2022). |
|---|---|
| Контроль качества | Data were checked for errors: 10% of MOTUs were randomly selected and checked by two people: taxonomic assignment was repeated and the number of reads per sample was confirmed. No errors were detected. |
Описание этапа методики:
- DNA extraction and amplification were performed by a dedicated DNA laboratory (SPYGEN, www.spygen.com). PCR amplification was performed using a universal vertebrate 12S mitochondrial rDNA primer pair Vert01 (TAGAACAGGCTCCTCTAG and TTAGATACCCCACTATGC, Taberlet et al. 2018). The amplicons were then sequenced using an Illumina MiSeq sequencer (Illumina, San Diego, CA, USA). The resulting sequence datasets (read sets) were analysed using the OBITools package (Boyer et al. 2015) for taxonomic assignment. Each MOTU, representing a grouping of sequences based on their molecular similarity, was associated with a number of reads per sample. MOTUs were named using the following nomenclature: Gua_Boui_V_Year_n°MOTU; with Gua for Guadeloupe, Boui, a 4-letter code for "Bouillante" (commune located on the shore the closest to the transect), V for the primer used, in this case specific to vertebrates, the sampling year (2021 or 2022), and a number corresponding to the order of appearance of the MOTU in the overall list. The taxonomic assignment of each MOTU was meticulously checked by hand. To compare the taxonomic resolution and the detection powers of different primers, two samples SPY210556 and SPY204197, respectively taken the 06/06/2021 and the 06/09/2021, were also analysed with a pair of primers specific to teleosts, Tele01 (ACACCGCCCGTCACTCT, CTTCCGGTACTACCATG, Valentini et al. 2016). Similarly, the 2021 samples (SPY204198, SPY204172, SPY210555 and SPY204197) were also analysed with a pair of Mamm01 mammal-specific primers (CCGCCCGTCACYCTCCT, GTAYRCTTACCWTGTTACGAC, Taberlet et al. 2018) and with a pair of cetacean-specific primers 175f-407r (CATACGATAAGTTAAAGCTCG, GATCATTACTAGCTACCCCC, Girardet & Jung. unpublished).
Библиографические ссылки
- Boyer, F., Mercier, C., Bonin, A., Le Bras, Y., Taberlet, P. and Coissac, E. (2016). obitools: a unix-inspired software package for DNA metabarcoding. Mol Ecol Resour 16, 176–182.
- Coché, L., Arnaud, E., Bouveret, L., David, R., Foulquier, E., Gandilhon, N., Jeannesson, E., Le Bras, Y., Lerigoleur, E., Lopez, P. J., et al. (2021). Kakila database: Towards a FAIR community approved database of cetacean presence in the waters of the Guadeloupe Archipelago, based on citizen science. Biodivers Data J 9, e69022.
- Dalongeville, A., Boulanger, E., Marques, V., Charbonnel, E., Hartmann, V., Santoni, M. C., Deter, J., Valentini, A., Lenfant, P., Boissery, P., et al. (2022). Benchmarking eleven biodiversity indicators based on environmental DNA surveys: More diverse functional traits and evolutionary lineages inside marine reserves. Journal of Applied Ecology59, 2803–2813.
- Taberlet, P., Bonin, A., Zinger, L. and Coissac, E. (2018). Environmental DNA: For Biodiversity Research and Monitoring. Oxford University Press.
- Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P. F., Bellemain, E., Besnard, A., Coissac, E., Boyer, F., et al. (2016). Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology 25, 929–942.
Дополнительные метаданные
| Альтернативные идентификаторы | https://doi.org/10.48579/PRO/EHR5AC |
|---|---|
| https://ipt.gbif.fr/resource?r=edna_marine_vertebrates_guadeloupe |