eDNA-based survey of the marine vertebrate biodiversity off the west coast of Guadeloupe (French West Indies)

Occurrence
Latest version published by MNHN - Museum national d'Histoire naturelle on Apr 15, 2024 MNHN - Museum national d'Histoire naturelle
Publication date:
15 April 2024
License:
CC-BY 4.0

Download the latest version of this resource data as a Darwin Core Archive (DwC-A) or the resource metadata as EML or RTF:

Data as a DwC-A file download 200 records in English (20 KB) - Update frequency: unknown
Metadata as an EML file download in English (30 KB)
Metadata as an RTF file download in English (17 KB)

Description

Data were collected during a dedicated campaign to study eDNA in the French Caribbean archipelago of Guadeloupe, organized and financed by the UMR ISYEB and the Labex DRIIHM, and beneficiating of a collaboration with the NGO OMMAG (Observatoire des Mammifères Marins de l’Archipel Guadeloupéen - Guadeloupe Archipelago Marine Mammal Observatory) for at sea campaigns.

The project consisted in taking and analysing eDNA samples using, on consecutive days, a same protocol on a same transect along the west coast of Guadeloupe. Twelve samples were taken. Two sampling phases were carried out: one in 2021 over four consecutive days, the other in 2022 over two consecutive days. eDNAs contained in the samples were analysed by metabarcoding using vertebrate–specific primers (Taberlet et al. 2018). The resulting dataset consisted in lists of vertebrate taxa identified from analysed MOTU (Molecular Taxonomic Unit - a grouping of sequences based on their molecular similarity) in the different samples. The taxonomic assignments were made at the most precise taxonomic rank possible.

The project resulted in a local taxonomic inventory of marine vertebrates based on eDNA. Comparison between samples provided an overview of the short and middle terms temporal variations in taxonomic composition at a single sampling point, as captured by our eDNA sampling and analysis protocols.

Data Records

The data in this occurrence resource has been published as a Darwin Core Archive (DwC-A), which is a standardized format for sharing biodiversity data as a set of one or more data tables. The core data table contains 200 records.

1 extension data tables also exist. An extension record supplies extra information about a core record. The number of records in each extension data table is illustrated below.

Occurrence (core)
200
dnaDerivedData 
200

This IPT archives the data and thus serves as the data repository. The data and resource metadata are available for download in the downloads section. The versions table lists other versions of the resource that have been made publicly available and allows tracking changes made to the resource over time.

Versions

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Haderlé R, Ung V, Jung J (2024). eDNA-based survey of the marine vertebrate biodiversity off the west coast of Guadeloupe (French West Indies). Version 1.7. MNHN - Museum national d'Histoire naturelle. Occurrence dataset. https://ipt.gbif.fr/resource?r=edna_marine_vertebrates_guadeloupe&v=1.7

Rights

Researchers should respect the following rights statement:

The publisher and rights holder of this work is MNHN - Museum national d'Histoire naturelle. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

This resource has not been registered with GBIF

Keywords

Occurrence; Environmental DNA; Vertebrates; West Indies; 12S Mitochondrial Ribosomal RNA; Metabarcoding

Contacts

Rachel Haderlé
  • Metadata Provider ●
  • Originator ●
  • Point Of Contact
PhD student
ISYEB
Visotheary Ung
  • Originator
Research engineer
ISYEB
Jean-Luc Jung
  • Originator
Research Director
ISYEB
Rachel HADERLE
  • User

Geographic Coverage

The Guadeloupe islands are located in the Caribbean Sea, at the heart of the Agoa sanctuary, a large marine protected area (over 143,000 km²) corresponding to the entire French Exclusive Economic Zone of the French West Indies and dedicated to the protection and conservation of marine mammals. The sampling area is located on the west coast of Guadeloupe island on the Caribbean Seaside, the leeward coast, off the commune of Bouillante in Basse Terre. The sampling transect was approximately 5 km long. This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). This specific zone was selected because of the drop-off and numerous sightings of cetaceans, with a particular emphasis on Physeter macrocephalus, as regularly reported by whale watchers in this area (Coché et al. 2021).

Bounding Coordinates South West [16.103, -61.841], North East [16.103, -61.841]

Taxonomic Coverage

N/A

Kingdom Animalia
Phylum Chordata
Class Mammalia, Actinopterygii
Order Stomiiformes, Beloniformes, Cetacea, Perciformes, Acanthuriformes, Scombriformes, Carangiformes, Aulopiformes, Acropomatiformes, Myctophiformes, Trachiniformes
Family Chiasmodontidae, Bramidae, Pomacanthidae, Stomiidae, Scombridae, Coryphaenidae, Exocoetidae, Carangidae, Myctophidae, Istiophoridae, Labridae, Chaetodontidae, Bathyclupeidae, Nomeidae, Scopelarchidae, Delphinidae, Lutjanidae, Belonidae, Hemiramphidae, Neoscopelidae, Pomacentridae, Evermannellidae, Gempylidae

Temporal Coverage

Start Date / End Date 2021-06-06 / 2022-02-11

Project Data

The project consisted in taking and analysing eDNA samples using, on consecutive days, a same protocol on a same transect along the west coast of Guadeloupe. Twelve samples were taken. Two sampling phases were carried out: one in 2021 over four consecutive days, the other in 2022 over two consecutive days. eDNAs contained in the samples were analysed by metabarcoding using vertebrate–specific primers (Taberlet et al. 2018).

Title eDNA-based survey of the marine vertebrate biodiversity off the west coast of Guadeloupe (French West Indies)
Funding Data were collected during a dedicated campaign to study eDNA in the French Caribbean archipelago of Guadeloupe, organized and financed by the UMR ISYEB and the Labex DRIIHM, and beneficiating of a collaboration with the NGO OMMAG (Observatoire des Mammifères Marins de l’Archipel Guadeloupéen - Guadeloupe Archipelago Marine Mammal Observatory) for at sea campaigns.
Study Area Description The Guadeloupe islands are located in the Caribbean Sea, at the heart of the Agoa sanctuary, a large marine protected area (over 143,000 km²) corresponding to the entire French Exclusive Economic Zone of the French West Indies and dedicated to the protection and conservation of marine mammals. The sampling area is located on the west coast of Guadeloupe island on the Caribbean Seaside, the leeward coast, off the commune of Bouillante in Basse Terre. The sampling transect was approximately 5 km long. This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). This specific zone was selected because of the drop-off and numerous sightings of cetaceans, with a particular emphasis on Physeter macrocephalus, as regularly reported by whale watchers in this area (Coché et al. 2021).

Sampling Methods

All samples were collected from a motorised rigid inflatable boat during 30 minutes at a 5-knot speed. For all samples, the boat followed a same transect defined on top of a marked bathymetric drop-off parallel to the coast. During each transect, two samples of seawater were collected in front of the boat, one from each side of the boat, just below the sea surface. For each sample, 30L of sea water were continuously filtered through a VigiDNA 0.2 μM filtration capsule (SPYGEN, France) using an Athena peristaltic pump (Proactive, Hamilton, NJ, USA), as described in Dalongeville et al. (2022). Right after the completion of the procedure, each capsule was filled with 80 mL of CL1 DNA preservation buffer (SPYGEN) and stored at room temperature until DNA extraction.

Study Extent This transect is located on a very marked bathymetric drop-off (over 1000 m deep) and links two GPS points with coordinates (16.125°, -61.849°) and (16.081°, -61.833°). Two sampling phases were carried out: one in 2021 on four consecutive days (from 06/06/2021 to 06/09/2021), the other in 2022 on two consecutive days (02/10/2022 and 02/11/2022).
Quality Control Data were checked for errors: 10% of MOTUs were randomly selected and checked by two people: taxonomic assignment was repeated and the number of reads per sample was confirmed. No errors were detected.

Method step description:

  1. DNA extraction and amplification were performed by a dedicated DNA laboratory (SPYGEN, www.spygen.com). PCR amplification was performed using a universal vertebrate 12S mitochondrial rDNA primer pair Vert01 (TAGAACAGGCTCCTCTAG and TTAGATACCCCACTATGC, Taberlet et al. 2018). The amplicons were then sequenced using an Illumina MiSeq sequencer (Illumina, San Diego, CA, USA). The resulting sequence datasets (read sets) were analysed using the OBITools package (Boyer et al. 2015) for taxonomic assignment. Each MOTU, representing a grouping of sequences based on their molecular similarity, was associated with a number of reads per sample. MOTUs were named using the following nomenclature: Gua_Boui_V_Year_n°MOTU; with Gua for Guadeloupe, Boui, a 4-letter code for "Bouillante" (commune located on the shore the closest to the transect), V for the primer used, in this case specific to vertebrates, the sampling year (2021 or 2022), and a number corresponding to the order of appearance of the MOTU in the overall list. The taxonomic assignment of each MOTU was meticulously checked by hand. To compare the taxonomic resolution and the detection powers of different primers, two samples SPY210556 and SPY204197, respectively taken the 06/06/2021 and the 06/09/2021, were also analysed with a pair of primers specific to teleosts, Tele01 (ACACCGCCCGTCACTCT, CTTCCGGTACTACCATG, Valentini et al. 2016). Similarly, the 2021 samples (SPY204198, SPY204172, SPY210555 and SPY204197) were also analysed with a pair of Mamm01 mammal-specific primers (CCGCCCGTCACYCTCCT, GTAYRCTTACCWTGTTACGAC, Taberlet et al. 2018) and with a pair of cetacean-specific primers 175f-407r (CATACGATAAGTTAAAGCTCG, GATCATTACTAGCTACCCCC, Girardet & Jung. unpublished).

Bibliographic Citations

  1. Boyer, F., Mercier, C., Bonin, A., Le Bras, Y., Taberlet, P. and Coissac, E. (2016). obitools: a unix-inspired software package for DNA metabarcoding. Mol Ecol Resour 16, 176–182.
  2. Coché, L., Arnaud, E., Bouveret, L., David, R., Foulquier, E., Gandilhon, N., Jeannesson, E., Le Bras, Y., Lerigoleur, E., Lopez, P. J., et al. (2021). Kakila database: Towards a FAIR community approved database of cetacean presence in the waters of the Guadeloupe Archipelago, based on citizen science. Biodivers Data J 9, e69022.
  3. Dalongeville, A., Boulanger, E., Marques, V., Charbonnel, E., Hartmann, V., Santoni, M. C., Deter, J., Valentini, A., Lenfant, P., Boissery, P., et al. (2022). Benchmarking eleven biodiversity indicators based on environmental DNA surveys: More diverse functional traits and evolutionary lineages inside marine reserves. Journal of Applied Ecology59, 2803–2813.
  4. Taberlet, P., Bonin, A., Zinger, L. and Coissac, E. (2018). Environmental DNA: For Biodiversity Research and Monitoring. Oxford University Press.
  5. Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P. F., Bellemain, E., Besnard, A., Coissac, E., Boyer, F., et al. (2016). Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology 25, 929–942.